Review



empty vector pbabe puro  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc empty vector pbabe puro
    Empty Vector Pbabe Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 581 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+vector+pbabe+puro/pBABE-puro+(Plasmid+%231764)/pmc12741039-149-2-5
    Average 96 stars, based on 581 article reviews
    empty vector pbabe puro - by Bioz Stars, 2026-10
    96/100 stars

    Images

    Related Articles

    Control:

    Article Title: The Proinflammatory Secretome of Senescent Cells Can Be Controlled by a HIF2A ‐Dependent Upregulation and a FURIN ‐Dependent Cleavage of the ANGPTL4 Secreted Factor
    Article Snippet: In order to overexpress ANGPTL4, ANGPTL4‐pBabe‐puro (Addgene plasmid #19156) plasmid was used (Padua et al. ). .. For control, empty vector pBabe‐puro (Addgene plasmid #1764) was used (Morgenstern and Land ). .. Lentiviral vectors coding shHIF2A, pLV[shRNA]‐Hygro‐U6 > hEPAS1[shRNA#1 targeted sequence GCGCAAATGTACCCAATGATA] (VectorBuilder) was used.

    Plasmid Preparation:

    Article Title: The Proinflammatory Secretome of Senescent Cells Can Be Controlled by a HIF2A ‐Dependent Upregulation and a FURIN ‐Dependent Cleavage of the ANGPTL4 Secreted Factor
    Article Snippet: In order to overexpress ANGPTL4, ANGPTL4‐pBabe‐puro (Addgene plasmid #19156) plasmid was used (Padua et al. ). .. For control, empty vector pBabe‐puro (Addgene plasmid #1764) was used (Morgenstern and Land ). .. Lentiviral vectors coding shHIF2A, pLV[shRNA]‐Hygro‐U6 > hEPAS1[shRNA#1 targeted sequence GCGCAAATGTACCCAATGATA] (VectorBuilder) was used.

    Article Title: In Vitro Validation of Computationally Predicted Oncogenic Driver Mutations in EGFR Tyrosine Kinase Domain
    Article Snippet: All cell lines were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco, Thermoscientific) containing 10% Fetal Bovine Serum (FBS, Gibco, Thermoscientific) and antibiotics (100 U/mL penicillin and 100 μg/mL streptomycin) in a humidified atmosphere of 5% CO2 at 37°C. .. EGFR wild type (pBABE-puro EGFR WT), EGFR known driver mutant L858R construct (pBABE-puro EGFR L858R), and empty vector (pBABE-puro) were purchased from Addgene. ..

    Mutagenesis:

    Article Title: In Vitro Validation of Computationally Predicted Oncogenic Driver Mutations in EGFR Tyrosine Kinase Domain
    Article Snippet: All cell lines were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco, Thermoscientific) containing 10% Fetal Bovine Serum (FBS, Gibco, Thermoscientific) and antibiotics (100 U/mL penicillin and 100 μg/mL streptomycin) in a humidified atmosphere of 5% CO2 at 37°C. .. EGFR wild type (pBABE-puro EGFR WT), EGFR known driver mutant L858R construct (pBABE-puro EGFR L858R), and empty vector (pBABE-puro) were purchased from Addgene. ..

    Construct:

    Article Title: In Vitro Validation of Computationally Predicted Oncogenic Driver Mutations in EGFR Tyrosine Kinase Domain
    Article Snippet: All cell lines were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco, Thermoscientific) containing 10% Fetal Bovine Serum (FBS, Gibco, Thermoscientific) and antibiotics (100 U/mL penicillin and 100 μg/mL streptomycin) in a humidified atmosphere of 5% CO2 at 37°C. .. EGFR wild type (pBABE-puro EGFR WT), EGFR known driver mutant L858R construct (pBABE-puro EGFR L858R), and empty vector (pBABE-puro) were purchased from Addgene. ..



    Similar Products

    99
    ATCC 2012 mda mb 468 pbabe puro empty vector cell line
    2012 Mda Mb 468 Pbabe Puro Empty Vector Cell Line, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+vector+pbabe+puro/MDA-MB-468/pm37009825-294-40-62
    Average 99 stars, based on 1 article reviews
    2012 mda mb 468 pbabe puro empty vector cell line - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    96
    Addgene inc empty vector pbabe puro
    Empty Vector Pbabe Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+vector+pbabe+puro/pBABE-puro+(Plasmid+%231764)/pmc12741039-149-2-5
    Average 96 stars, based on 1 article reviews
    empty vector pbabe puro - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    93
    Addgene inc pbabe puro empty vector
    Pbabe Puro Empty Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+vector+pbabe+puro/pBabe(puro)-Omi-mCherry+(Plasmid+%2348685)/pmc11949035-240-1-11
    Average 93 stars, based on 1 article reviews
    pbabe puro empty vector - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    93
    Addgene inc pbabe puro empty vector ev
    Pbabe Puro Empty Vector Ev, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+vector+pbabe+puro/pBABEpuro-gateway+(Plasmid+%2351070)/pm38672507-74-26-30
    Average 93 stars, based on 1 article reviews
    pbabe puro empty vector ev - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    96
    Addgene inc pbabe puro empty vector control
    Pbabe Puro Empty Vector Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+vector+pbabe+puro/pBABE-puro+(Plasmid+%231764)/10__1158_slash_2767___9764__crc___23___0379-57-43-47
    Average 96 stars, based on 1 article reviews
    pbabe puro empty vector control - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    90
    Addgene inc pbabe-puro empty vector
    Pbabe Puro Empty Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+vector+pbabe+puro/gcamp6s/pm37082139-246-8-8
    Average 90 stars, based on 1 article reviews
    pbabe-puro empty vector - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    Image Search Results